| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.017800 |
| Chromosome: | chromosome 17 |
| Location: | 5662229 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g738500 | (1 of 1) PF14661 - HAUS augmin-like complex subunit 6 N-terminus (HAUS6_N) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCTGCTCGGATTTGGGAT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1325 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 866 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAGCGCAGTGAACAGTCA |
| Suggested primer 2: | TTCTGATGGCTGACGTTGAC |