| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.017974 |
| Chromosome: | chromosome 10 |
| Location: | 6423232 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g465850 | (1 of 1) K12572 - PAB-dependent poly(A)-specific ribonuclease subunit 3 (PAN3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGTTGGCTGTTGGCTGGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 493 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAGGACTACTGGGGGTGA |
| Suggested primer 2: | CTTGCCTGCGATGTGTAGAA |