| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.018016 |
| Chromosome: | chromosome 3 |
| Location: | 3800695 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g170300 | SUB5 | (1 of 1) 3.4.24.30 - Coccolysin / Streptococcus thermophilus intracellular proteinase; Subtilisin-like protease | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTAGAAAGAATCCGCTGAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1194 |
| LEAP-Seq percent confirming: | 96.8051 |
| LEAP-Seq n confirming: | 303 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATACCCGCAGTGACTCGT |
| Suggested primer 2: | TGCTACGGCTACTGCTGCTA |