| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.018197 |
| Chromosome: | chromosome 10 |
| Location: | 3037667 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g441300 | (1 of 11) IPR001471//IPR016177//IPR031112 - AP2/ERF domain // DNA-binding domain // AP2-like ethylene-responsive transcription factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTCTGTATGCATGTGCTCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1312 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 418 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTCCGTCAAACGTGTTC |
| Suggested primer 2: | CCCACTGAGCTGCCAGTAAT |