| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.018329 |
| Chromosome: | chromosome 7 |
| Location: | 4113822 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g342900 | (1 of 2) 2.7.1.100 - S-methyl-5-thioribose kinase / MTR kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGCAGCCAGCGTCAGCCCC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 915 |
| LEAP-Seq percent confirming: | 99.5327 |
| LEAP-Seq n confirming: | 426 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACTGATCCTTTCGCTTTC |
| Suggested primer 2: | GACACGAATGTCACAGACCG |