| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.018339 |
| Chromosome: | chromosome 9 |
| Location: | 6482769 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g407300 | (1 of 32) 3.1.1.3 - Triacylglycerol lipase / Triglyceride lipase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGTGTGTGGTGCCGCGT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 635 |
| LEAP-Seq percent confirming: | 70.2703 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCTTCACTTCTCCTCAAC |
| Suggested primer 2: | GCTTGTCGATTCGCTCTACC |