| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.018363 |
| Chromosome: | chromosome 2 |
| Location: | 1658015 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g085600 | (1 of 2) IPR005645//IPR029058 - Serine hydrolase FSH // Alpha/Beta hydrolase fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTTTGCGCCACCCTTTGTG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1185 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 186 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCTGCATTGAAGTAATGA |
| Suggested primer 2: | GGTGTAGGTCGGTCATTGCT |