| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.018403 |
| Chromosome: | chromosome 10 |
| Location: | 4794468 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g453807 | CTPB1 | (1 of 2) PTHR32060:SF5 - PEPTIDASE S41 FAMILY PROTEIN; C-terminal peptidase B | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCAACAACGCTCCCCCCTCG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 927 |
| LEAP-Seq percent confirming: | 98.6487 |
| LEAP-Seq n confirming: | 73 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACGTCAACAAACAGCTA |
| Suggested primer 2: | ATACGCTGTCTTTGCGCTTT |