| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.018505 |
| Chromosome: | chromosome 9 |
| Location: | 1142144 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g400150 | (1 of 2) PF13415//PF13418 - Galactose oxidase, central domain (Kelch_3) // Galactose oxidase, central domain (Kelch_4) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGTGCGAGTCCGTCTAGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 711 |
| LEAP-Seq percent confirming: | 85.0575 |
| LEAP-Seq n confirming: | 444 |
| LEAP-Seq n nonconfirming: | 78 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGAGCAGTCGTGCCATAC |
| Suggested primer 2: | CAAAACGACGTTCAGTCGAA |