| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.018653 |
| Chromosome: | chromosome 7 |
| Location: | 481841 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g315700 | FKB4,FKB16-1,FKB16A | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 1) PTHR10516//PTHR10516:SF250 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE // PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP16-1, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGTGCGGCTCGGGTACGT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 694 |
| LEAP-Seq percent confirming: | 97.0414 |
| LEAP-Seq n confirming: | 164 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTTGGACTGTGAGCATGA |
| Suggested primer 2: | TGAAAGTTTCCCTTGCAACC |