| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.018899 |
| Chromosome: | chromosome 17 |
| Location: | 6259166 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g742400 | PTK17 | Protein tyrosine kinase; (1 of 1) IPR000014//IPR000104//IPR000719//IPR001245//IPR002290//IPR011009//IPR020635 - PAS domain // Antifreeze protein, type I // Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTACGACGAGCGCCAGAG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 897 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 51 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTATGCATCGGGTCTTCGT |
| Suggested primer 2: | ATGAGCTCTTTGATGTCCCG |