| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.019016 |
| Chromosome: | chromosome 12 |
| Location: | 6209698 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g536600 | FAP78 | Flagellar Associated Protein 78; (1 of 7) PTHR11584:SF381 - PROTEIN PQN-80, ISOFORM B | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCCGCCAAATGGGACCAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1484 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 115 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCATTTGCACGCAGTAT |
| Suggested primer 2: | TAGCCATAGGCTCGCATTCT |