| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.019055 |
| Chromosome: | chromosome 3 |
| Location: | 6540481 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g195500 | TGL9 | (1 of 5) PF01734 - Patatin-like phospholipase (Patatin); Putative triacylglycerol lipase | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCCGCCACCCCACAGGAC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1413 |
| LEAP-Seq percent confirming: | 97.7987 |
| LEAP-Seq n confirming: | 622 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGTTCTACATGGACGGC |
| Suggested primer 2: | CGCATTCCCCCTAGTAAACA |