| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.019149 |
| Chromosome: | chromosome 1 |
| Location: | 6797028 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g048950 | PYR5 | Uridine 5'- monophosphate synthase; (1 of 1) 2.4.2.10//4.1.1.23 - Orotate phosphoribosyltransferase / Orotidylic acid phosphorylase // Orotidine-5'-phosphate decarboxylase / Uridine 5'-monophosphate synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCTATTGGTCAAGTCTTC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1335 |
| LEAP-Seq percent confirming: | 95.2849 |
| LEAP-Seq n confirming: | 485 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTGCGTACACGTTAGAGA |
| Suggested primer 2: | TCTGCAAGCAAAACGACATC |