| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.019204 |
| Chromosome: | chromosome 14 |
| Location: | 1424270 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g617700 | PDE1,PDE2 | (1 of 20) 3.1.4.17 - 3',5'-cyclic-nucleotide phosphodiesterase / Cyclic AMP phosphodiesterase; 3'%252C5'-cyclic-nucleotide phosphodiesterase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGGGGAAGGGGCGAAGGAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 875 |
| LEAP-Seq percent confirming: | 99.4186 |
| LEAP-Seq n confirming: | 171 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCCTGTACACACAGACCT |
| Suggested primer 2: | GGCTCAACTGGTGGTGAAAT |