| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.019358 |
| Chromosome: | chromosome 1 |
| Location: | 5853339 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g041800 | (1 of 52) 2.7.11.22 - Cyclin-dependent kinase / Cdk-activating protein kinase | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTGCTTGCATACCAGAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 618 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTAGGGTAGCCCTCCTCC |
| Suggested primer 2: | AAAATCCTCAAACACGCTCG |