Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.SG0182.019423 |
Chromosome: | chromosome 10 |
Location: | 830633 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g423550 | ATA2 | threonine aldolase; (1 of 1) 4.1.2.49 - L-allo-threonine aldolase | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTGTATGCCATGCCAAA |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 959 |
LEAP-Seq percent confirming: | 98.268 |
LEAP-Seq n confirming: | 1078 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGGAGTCTAGGGGACACA |
Suggested primer 2: | CTTCGACTCAACCAGGAAGC |