| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.019593 |
| Chromosome: | chromosome 6 |
| Location: | 2808365 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g271250 | HTR8 | Histone H3; (1 of 35) K11253 - histone H3 (H3) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGCCCGCCATATAAAAAG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 841 |
| LEAP-Seq percent confirming: | 98.4127 |
| LEAP-Seq n confirming: | 62 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGTCGTTCCAGCAGATCA |
| Suggested primer 2: | GACAGCCTTAAGGGGTAGGG |