| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.019666 |
| Chromosome: | chromosome 16 |
| Location: | 4057869 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g669950 | ALG14 | (1 of 1) K07441 - beta-1,4-N-acetylglucosaminyltransferase (ALG14); Subunit of UDP-GlcNAc transferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGACCTTCTGCCTTACTT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1287 |
| LEAP-Seq percent confirming: | 99.7828 |
| LEAP-Seq n confirming: | 919 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAGGTGTCGGGTTAGGAA |
| Suggested primer 2: | ACTACTTCCCGAGCGAGTGA |