| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.019692 |
| Chromosome: | chromosome 3 |
| Location: | 3819423 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g170550 | POC4 | Proteome of centriole protein 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGCCCGCATACAGCACCG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1530 |
| LEAP-Seq percent confirming: | 93.7743 |
| LEAP-Seq n confirming: | 241 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAACCGCCAGGTGTTTAAG |
| Suggested primer 2: | CGTAGAGGGTTCAGGCTCAG |