| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.019874 |
| Chromosome: | chromosome 7 |
| Location: | 3831156 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g338550 | (1 of 1) IPR002048//IPR006585//IPR006652//IPR008979//IPR011043//IPR011050 - EF-hand domain // Fucolectin tachylectin-4 pentraxin-1 // Kelch repeat type 1 // Galactose-binding domain-like // Galactose oxidase/kelch, beta-propeller // Pectin lyase fold/virulence factor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTCAAGCGCATACTTCGTG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1043 |
| LEAP-Seq percent confirming: | 86.4407 |
| LEAP-Seq n confirming: | 102 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCCTGCATGCAACCTACC |
| Suggested primer 2: | GGTGTTTGTGGAGCTTTGGT |