| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.019890 |
| Chromosome: | chromosome 12 |
| Location: | 5501661 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531000 | AMT1H,AMT8 | Ammonium transporter; (1 of 8) K03320 - ammonium transporter, Amt family (amt, AMT, MEP) | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTACCCCGCGACCTGGCCC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 960 |
| LEAP-Seq percent confirming: | 98.6577 |
| LEAP-Seq n confirming: | 147 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTGGATCAGGCAATCAG |
| Suggested primer 2: | CAGGTTCTATAGGCCCCTCC |