Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.019973 |
Chromosome: | chromosome 3 |
Location: | 5754076 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g188400 | RBO2,RBOL2 | (1 of 2) 1.6.3.1 - NAD(P)H oxidase (H(2)O(2)-forming) / Thyroid oxidase 2; Respiratory burst oxidase | intron |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | ACTGGCCGAGCGAGTCCCAG |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1046 |
LEAP-Seq percent confirming: | 99.0196 |
LEAP-Seq n confirming: | 1111 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCGCATTCTGTTTCAAGTA |
Suggested primer 2: | CGCTCACCAGTCACGAAGTA |