| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.020226 |
| Chromosome: | chromosome 1 |
| Location: | 941641 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g005150 | SGA1 | Serine glyoxylate aminotransferase; (1 of 1) 2.6.1.44//2.6.1.45//2.6.1.51 - Alanine--glyoxylate transaminase / Alanine--glyoxylate aminotransferase // Serine--glyoxylate transaminase / SGAT // Serine--pyruvate transaminase / Serine--pyruvate aminotransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGTCGGTTGTGAAGAACCC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1256 |
| LEAP-Seq percent confirming: | 95.3642 |
| LEAP-Seq n confirming: | 432 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGAGTCTGGGGCTCAAAAG |
| Suggested primer 2: | CGAAGCAGTATGTTGCAGGA |