Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.020260 |
Chromosome: | chromosome 7 |
Location: | 2213028 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g327200 | (1 of 3) PF00534//PF13579 - Glycosyl transferases group 1 (Glycos_transf_1) // Glycosyl transferase 4-like domain (Glyco_trans_4_4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGCCCCACACACAAAACC |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1304 |
LEAP-Seq percent confirming: | 99.7917 |
LEAP-Seq n confirming: | 479 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAAGGACTGCGCATGTAAG |
Suggested primer 2: | GAGCGTGTCAGCGTCAGTTA |