| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.000056 |
| Chromosome: | chromosome 12 |
| Location: | 3467859 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g497300 | TEF2,CAS,CAS1 | Rhodanese-like Ca-sensing receptor; (1 of 25) PF00581 - Rhodanese-like domain (Rhodanese) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCAAGGCCGGTATCACCACCCTGCAGAGCGGTGTGAAGATCCTGAAGG |
| Internal bar code: | CCACTGAAATATCACCGGTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2265 |
| LEAP-Seq percent confirming: | 41.8182 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTTGTCTGCCCTCCCATT |
| Suggested primer 2: | TCAGGTGTTGCATAAGCCGT |