| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.000346 |
| Chromosome: | chromosome 3 |
| Location: | 1135842 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g148950 | CGL43,SRRP1,PNT1 | Ortholog of PSII biogenesis protein SRRP1; (1 of 3) IPR003029//IPR012340//IPR022967 - S1 domain // Nucleic acid-binding, OB-fold // RNA-binding domain, S1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCGGGTCTCGGGAGCCCATCCTGACGGGTTTCGGGAAGGGCCCCACA |
| Internal bar code: | GGGTCATTCATGTCTTAGTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1397 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCGTTCGCGAGTTGTAG |
| Suggested primer 2: | GGCAGAGTTGTCACAGACGA |