| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.000413 |
| Chromosome: | chromosome 6 |
| Location: | 2964246 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g273700 | HCF136 | (1 of 1) PTHR32010//PTHR32010:SF6 - FAMILY NOT NAMED // PHOTOSYSTEM II STABILITY/ASSEMBLY FACTOR HCF136, CHLOROPLASTIC; Photosystem II stability/assembly factor HCF136 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATTCTTGTCCTGCTAACAAAACTGGTGGGATAGTCAAGCCCCCACGGG |
| Internal bar code: | TTGGCGTAATCGGGTCTTCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1547 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACAACACGCCAACCTGAC |
| Suggested primer 2: | GGGAAGCCGTACCACATGAA |