Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.000421 |
Chromosome: | chromosome 12 |
Location: | 6636242 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g539100 | HEL57 | (1 of 1) K14811 - ATP-dependent RNA helicase DBP3 [EC:3.6.4.13] (DBP3); DEAD box RNA helicase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAAAGGCCATCAGACTGACCATCTCGACCATCGCCGCCGGCGTTCGTAT |
Internal bar code: | ATAACGTACTGAACTCTGCGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 76 |
LEAP-Seq percent confirming: | 4.34783 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGTTCGCTAGCACAGAAA |
Suggested primer 2: | TGATGGTGGTGATGGTGGTG |