| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.000520 |
| Chromosome: | chromosome 10 |
| Location: | 4936165 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g453900 | CYN71 | (1 of 1) K12736 - peptidylprolyl isomerase domain and WD repeat-containing protein 1 [EC:5.2.1.8] (PPWD1); Cyclophilin 71 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACTGGAGACGCGCATGCCAATGCACGTGTTTCGTCTGACCAGGGCACG |
| Internal bar code: | CCACGGGTCGTGTGCTGGATCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1395 |
| LEAP-Seq percent confirming: | 94.7368 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCGAGTTCTCCACCTTGC |
| Suggested primer 2: | TGTTTTGTCTGGGGGCCTTT |