| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.000859 |
| Chromosome: | chromosome 12 |
| Location: | 3342029 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498500 | DEG1C,DEG11 | (1 of 1) PF00089//PF13180 - Trypsin (Trypsin) // PDZ domain (PDZ_2); Deg protease | 5'UTR |
| Cre12.g498550 | MPM1,CHLM1,CHLM | Mg protoporphyrin IX S-adenosyl methionine O-methyl transferase; (1 of 1) K03428 - magnesium-protoporphyrin O-methyltransferase (E2.1.1.11, chlM, bchM) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCCCCATTCTTTGCCCGCAAACCGGTTTCCCGCAGGCCGCGCCTTGTG |
| Internal bar code: | GCCGTAAAAGCTTACACAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1204 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACTAACAGCCATGCGATG |
| Suggested primer 2: | CTCACCGCCTCCTTCTCATC |