Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.000889 |
Chromosome: | chromosome 3 |
Location: | 5012192 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g179800 | LCI24 | Low-CO2-inducible membrane protein; (1 of 5) PF07466 - Protein of unknown function (DUF1517) (DUF1517) | 3'UTR |
Cre03.g179820 | 3'UTR | ||
lncRNA_TCONS_00067107 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACTATATTTCATGTAAGTCTGCTTTGCATGCGCCCCCAGGGCTCGGAG |
Internal bar code: | AGGCTCACTTGGGGACCAGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 992 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 50 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCCATGACGTTCACGGAGG |
Suggested primer 2: | CTGTTTGAACTTGGCACCCG |