| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.000979 |
| Chromosome: | chromosome 6 |
| Location: | 5990220 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g290400 | HDA5 | (1 of 1) PTHR10625:SF104 - HISTONE DEACETYLASE 6; RPD3/HDA1 type histone deacetylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTATGAGCATTGATTAACAATGGGTGGTGCTCCGGCTGGTGCGCGTGG |
| Internal bar code: | TTGTACGTAGGCATGCCGCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5547 |
| LEAP-Seq percent confirming: | 73.6842 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGTGATGGGGCCTAGATC |
| Suggested primer 2: | ATGTACATGTGCGTGTGGGT |