| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.001003 |
| Chromosome: | chromosome 12 |
| Location: | 2484772 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g507300 | LCI30 | (1 of 1) K14842 - ribosome biogenesis protein NSA2 (NSA2); Low-CO2-inducible protein 30 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAACAGGCGGCTATGCGTGGGCGCATTTGTTAGGGACGCACAAGGACGC |
| Internal bar code: | TGTTACTACGATTTTTTTGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2393 |
| LEAP-Seq percent confirming: | 46.1538 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTCCACCTAGCAGACGAT |
| Suggested primer 2: | TAATGAAGCACTGGTGGCGT |