| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.001051 |
| Chromosome: | chromosome 3 |
| Location: | 5010660 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g179800 | LCI24 | Low-CO2-inducible membrane protein; (1 of 5) PF07466 - Protein of unknown function (DUF1517) (DUF1517) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGACTAGCTCAGCCTACCTTACAACTAAGTGCGCGTACACCAATACCCT |
| Internal bar code: | GGGGGTGACACAAAGATATTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1546 |
| LEAP-Seq percent confirming: | 13.6364 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGTGCCAAGTTCAAACAG |
| Suggested primer 2: | ACGCGCTGGACTTGTCTTTA |