Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.001089 |
Chromosome: | chromosome 6 |
Location: | 2966991 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g273700 | HCF136 | (1 of 1) PTHR32010//PTHR32010:SF6 - FAMILY NOT NAMED // PHOTOSYSTEM II STABILITY/ASSEMBLY FACTOR HCF136, CHLOROPLASTIC; Photosystem II stability/assembly factor HCF136 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAAACTCGGCACCCCCGACCAGTCCCCCGCGCCGGCTTGGGACGCCCC |
Internal bar code: | ACCACTCACGCAGTCCCCACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2214 |
LEAP-Seq percent confirming: | 91.7808 |
LEAP-Seq n confirming: | 67 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTGGTGTGCAGACTTGGT |
Suggested primer 2: | GAGGTCAGTCGCCTATGCTC |