| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.001118 |
| Chromosome: | chromosome 16 |
| Location: | 2663570 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g661550 | (1 of 1) PF06941 - 5' nucleotidase, deoxy (Pyrimidine), cytosolic type C protein (NT5C) (NT5C) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTCCACGCCACATTGGCCAGGATGCACCCTGCAAGTTGGTGAGGGCCG |
| Internal bar code: | AGTTGTTTGGTGCATTGGGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1879 |
| LEAP-Seq percent confirming: | 93.75 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCCATCACACATCCACGT |
| Suggested primer 2: | TTGTGCCACTCTCCGTTCTC |