Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.001150 |
Chromosome: | chromosome 7 |
Location: | 2454395 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g329150 | SPL21,SPLH1 | DEAH-box helicase, possible nuclear pre-mRNA splicing factor, N-terminal; (1 of 3) K12818 - ATP-dependent RNA helicase DHX8/PRP22 (DHX8, PRP22) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTGTGCATTTTGACGGTACCGGCATAGTAGGCGTCAGGGGCGTTAAC |
Internal bar code: | GAAAGTTCGGAGAAATTGAATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1139 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATTCATACATGCACGCGC |
Suggested primer 2: | GTTGGTGTAGAGGCGTGTGA |