| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.001180 |
| Chromosome: | chromosome 12 |
| Location: | 456393 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g494750 | PRPS20 | Chloroplast ribosomal protein S20; (1 of 1) K02968 - small subunit ribosomal protein S20 (RP-S20, rpsT) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGGTCAGGAGAGGCGTGGTTAGGCAGCCGGAGTAGAGACAGTGGCAGT |
| Internal bar code: | AGAACATTAGTTCGGTACGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5775 |
| LEAP-Seq percent confirming: | 99.0909 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 110 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGATAGGGGTGTTCGATG |
| Suggested primer 2: | AAGAAGAAGATGCCCAGCCC |