| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.001420 |
| Chromosome: | chromosome 2 |
| Location: | 4671844 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g107700 | (1 of 2) IPR001611//IPR001810//IPR003591 - Leucine-rich repeat // F-box domain // Leucine-rich repeat, typical subtype | 3'UTR | |
| Cre02.g107750 | PCD1 | Polyketide cyclase/dehydrase; (1 of 4) PF03364 - Polyketide cyclase / dehydrase and lipid transport (Polyketide_cyc) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCCCGTCTGTCGGGTCACTGGGTCCGTGCGCATCATCTAAGGCCAGGT |
| Internal bar code: | GCAAACAGGGGGTAAGGATTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 162 |
| LEAP-Seq percent confirming: | 4.87805 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCTGTTGCTGGACTGTTG |
| Suggested primer 2: | TGCTGCTTCTGGGTATGGTG |