Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.001429 |
Chromosome: | chromosome 6 |
Location: | 7155268 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g298300 | PPR2,MRL1 | rbcL mRNA stabilization factor; (1 of 2) PF01535//PF13812 - PPR repeat (PPR) // Pentatricopeptide repeat domain (PPR_3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTCAACCGTGGTAGTGGCAACGAAGCAAGCGATCTTGCCCCGGCAGCT |
Internal bar code: | ATTTGGCCGCCAGGTGTATTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3292 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 40 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCCACTTGTGTGTTCACGC |
Suggested primer 2: | GCATCTGTCCATCAACGTGC |