| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.001491 |
| Chromosome: | chromosome 3 |
| Location: | 4498296 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g175800 | RIMM,RRM16 | Putative chloroplast ribosomal RNA small subunit methyltransferase E; (1 of 1) 2.1.1.193 - 16S rRNA (uracil(1498)-N(3))-methyltransferase / M(3)U(1498) specific methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGAACTGAGTAGATAGGGCTTCCGTGAAGACGCGTGCCGCATGGCGTGT |
| Internal bar code: | TATTGTTGAAATTTTCACAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 703 |
| LEAP-Seq percent confirming: | 36.8421 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGACCGGTTTGTTGCGTTG |
| Suggested primer 2: | GCACTTGTGGACCTTGCAAG |