| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.001543 |
| Chromosome: | chromosome 12 |
| Location: | 6031694 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g534650 | (1 of 66) 2.7.12.1 - Dual-specificity kinase | 5'UTR | |
| Cre12.g534700 | FKB19 | (1 of 1) PTHR10516:SF179 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP19, CHLOROPLASTIC; peptidyl-prolyl cis-trans isomerase, FKBP-type | gene_edge/outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAATGTTGTCACTGCATTCAAGGTCCCGCGGACGCCTGGGCCCCGAGGG |
| Internal bar code: | TGAGTAGCGTGGCATTTTCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2133 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 87 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACAGTGGTAACTTCGGA |
| Suggested primer 2: | CGCTTTGGTGGGACCCTTAT |