Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.001554 |
Chromosome: | chromosome 12 |
Location: | 8614949 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g548400 | LHCBM2 | (1 of 3) K08913 - light-harvesting complex II chlorophyll a/b binding protein 2 (LHCB2); Light-harvesting protein of photosystem II | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTCGTGACCTTCGCATCTAGGGTTCTCGTAAGACCTTCCGCAGCCGGT |
Internal bar code: | AAGCGAGAATATAATTAGGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4594 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 71 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGATCAGGTTCTCGTTGCC |
Suggested primer 2: | ACTCGTTCTACGCGCCTATG |