| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.001665 |
| Chromosome: | chromosome 7 |
| Location: | 4634484 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g344550 | (1 of 3) 1.1.1.95 - Phosphoglycerate dehydrogenase / Phosphoglyceric acid dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATACCGAACATGTTACTAGGTGCCATCACTCCACCTCCTCTTCCATTAT |
| Internal bar code: | GAAAGGAATATAAGTGGCCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3425 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGACCTGGGGGAAGTTGAC |
| Suggested primer 2: | ACCTGCTCATGCTGCTTCTT |