| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.001769 |
| Chromosome: | chromosome 7 |
| Location: | 428669 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g315100 | (1 of 2) 1.5.4.1 - Pyrimidodiazepine synthase | intron | |
| lncRNA_TCONS_00047798 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCAAAGTGCCTCTTCTGTCTTAACTACATGAATCAGCTGACATGCAAT |
| Internal bar code: | TCGCTAATTATATAACTCGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 824 |
| LEAP-Seq percent confirming: | 76.4706 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATCCCCACGGTAGCCTCAA |
| Suggested primer 2: | GGCAAAAGACACACGTGGAC |