| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.001946 |
| Chromosome: | chromosome 16 |
| Location: | 7015551 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g673617 | PRF1,PRFA1 | Putative chloroplast peptide chain release factor 1; (1 of 2) PTHR11075:SF9 - PEPTIDE CHAIN RELEASE FACTOR 1, MITOCHONDRIAL-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCGGTCTGGGCCGGTGGCCTACCCCAGTAGGTAACTCGGCCGGCGGCC |
| Internal bar code: | CCCCTCAGTAAAAGGGTGCAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5144 |
| LEAP-Seq percent confirming: | 95.7265 |
| LEAP-Seq n confirming: | 224 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 234 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGCGACCATTGTTATGAC |
| Suggested primer 2: | AGGTGGCTGGGTTGATAACG |