Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.001967 |
Chromosome: | chromosome 12 |
Location: | 2003272 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g510800 | CHLI2 | (1 of 2) PTHR32039//PTHR32039:SF9 - FAMILY NOT NAMED // MAGNESIUM-CHELATASE SUBUNIT CHLI-2, CHLOROPLASTIC; Magnesium chelatase subunit I, isoform 2 with histidine kinase activity | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGACACAGAACCCGATAATAGCTCCCAGATCGCCAAGGGGTGAGGCGGG |
Internal bar code: | GCTTGTCTATACAGGAGACTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2216 |
LEAP-Seq percent confirming: | 97.0588 |
LEAP-Seq n confirming: | 33 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGACCGACCTTTCCCAACAT |
Suggested primer 2: | GGACGGGTGTAGGATAAGCG |