| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.002141 |
| Chromosome: | chromosome 2 |
| Location: | 3374569 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g098250 | PPO3 | (1 of 1) PF10615//PF13883 - Protein of unknown function (DUF2470) (DUF2470) // Pyridoxamine 5'-phosphate oxidase (Pyrid_oxidase_2); Pyridoxamine 5'-phosphate oxidase-like protein | 3'UTR |
| Cre02.g098300 | (1 of 1) K11547 - kinetochore protein NDC80 (NDC80, HEC1, TID3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCTCCAAAACTTGGCAAGTCCGGCTCAGGCGGCTTGCCGTTTGCGTC |
| Internal bar code: | GGGGGCTTAGCCAAGACTCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2011 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGACGAAGAAGGCCAAGGG |
| Suggested primer 2: | GTCGGATGATCAGAGCTGGG |