| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.002204 |
| Chromosome: | chromosome 10 |
| Location: | 1182789 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g425900 | LHCA5 | (1 of 2) K08910 - light-harvesting complex I chlorophyll a/b binding protein 4 (LHCA4); Light-harvesting protein 5 of photosystem I | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCTACGAGGCTGGCCTGCCCCAGAACCTGCCCGAGCCCTTCACCAACA |
| Internal bar code: | GGGATTACCAGCGACGATCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1934 |
| LEAP-Seq percent confirming: | 94.2857 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAACTGTCAGCACCTGTG |
| Suggested primer 2: | CCCGGTCATACAAACCACCA |